Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pscAAV-GFP
(Plasmid #32396)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 32396 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSub201
  • Backbone size w/o insert (bp) 8310
  • Vector type
    Mammalian Expression, AAV ; Adeno-Associated Virus

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Users must confirm the absence of deletions (recombinations) in this vector by diagnostic digests. (1) An AhdI digest should produce the following pattern of bands: 1557 bp, 1478 bp and 1334 bp. (2) An SrfI digest should produce the following pattern of bands: 2801 bp and 1546 bp. Please consult the associated publication listed below for an example gel image. *See Addgene note below regarding the band sizes.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    GFP
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Multiple (see map) (not destroyed)
  • 3′ cloning site Multiple (see map) (not destroyed)
  • 5′ sequencing primer TGGCACCAAAATCAACGGGACTTTCCAAAATGT
  • 3′ sequencing primer AAAACCTCCCACACCTCCCCCTGAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that Addgene detected a 22 bp deletion which may affect packaging efficiency but does not affect the overall plasmid function. Please screen multiple colonies as noted by the depositor in the growth instructions. The exact number of bases is different compared to the Addgene verified sequence, however they are approximately the same size.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pscAAV-GFP was a gift from John T Gray (Addgene plasmid # 32396 ; http://n2t.net/addgene:32396 ; RRID:Addgene_32396)
  • For your References section:

    Design and Construction of Functional AAV Vectors. Gray JT, Zolotukhin S. Methods Mol Biol. 2011;807:25-46. 10.1007/978-1-61779-370-7_2 PubMed 22034025