pCCL-MUC5ACPromoter-FLuc-CMV-RLuc-dsRed2
(Plasmid
#215327)
-
PurposeLentiviral mammalian vector with firefly luciferase reporter for MUC5AC expression; renilla luciferase and dsRed2 reporter under CMV promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 215327 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCCL-NoPromoter-FLuc-CMV-RLuc-dsRed2
- Backbone size w/o insert (bp) 10530
- Total vector size (bp) 11589
-
Vector typeMammalian Expression, Lentiviral, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMUC5AC Promoter
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1059
- Promoter MUC5AC
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer AATTGTCTCGAGACTCACTGGGACCTTTCTGT
- 3′ sequencing primer AATTCAGGATCCCAGCTTCCTCCGGCCAACAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.02.09.579635 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCCL-MUC5ACPromoter-FLuc-CMV-RLuc-dsRed2 was a gift from Rob Hynds (Addgene plasmid # 215327 ; http://n2t.net/addgene:215327 ; RRID:Addgene_215327) -
For your References section:
A lentiviral toolkit to monitor airway epithelial cell differentiation using bioluminescence. Orr JC, Laali A, Durrenberger PF, Lazarus KA, El Mdawar MB, Janes SM, Hynds RE. Am J Physiol Lung Cell Mol Physiol. 2024 Oct 1;327(4):L587-L599. doi: 10.1152/ajplung.00047.2024. Epub 2024 Aug 13. 10.1152/ajplung.00047.2024 PubMed 39137525