Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #21542)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 21542 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    contain only aa478-860
  • GenBank ID
  • Entrez Gene
    AGO2 (a.k.a. CASC7, EIF2C2, LINC00980, PPD, Q10)
  • Tag / Fusion Protein
    • GST (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bam HI (destroyed during cloning)
  • 3′ cloning site Not I (not destroyed)
  • 5′ sequencing primer CAGCAAGTATATAGCATGGC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GST-PIWI(aa478-860) was a gift from Edward Chan (Addgene plasmid # 21542 ; ; RRID:Addgene_21542)
  • For your References section:

    The C-terminal half of human Ago2 binds to multiple GW-rich regions of GW182 and requires GW182 to mediate silencing. Lian SL, Li S, Abadal GX, Pauley BA, Fritzler MJ, Chan EK. RNA. 2009 May . 15(5):804-13. 10.1261/rna.1229409 PubMed 19324964