pgRNA
(Plasmid
#215560)
-
PurposeConstitutively expressed sgRNA targeting a desired gene (this case pta), ColE1 origin, KanR
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 215560 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepgRNA
- Backbone size w/o insert (bp) 2521
- Total vector size (bp) 2541
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namegRNA
-
Alt nameguide RNA targeting at pta
-
gRNA/shRNA sequencecaaactggtgcttacgtgtc
-
SpeciesSynthetic
- Promoter J23119
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer NA
- 3′ sequencing primer NA
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pgRNA was a gift from Brian Pfleger (Addgene plasmid # 215560 ; http://n2t.net/addgene:215560 ; RRID:Addgene_215560) -
For your References section:
Anaerobic production of medium-chain fatty alcohols via a beta-reduction pathway. Mehrer CR, Incha MR, Politz MC, Pfleger BF. Metab Eng. 2018 Jul;48:63-71. doi: 10.1016/j.ymben.2018.05.011. Epub 2018 May 25. 10.1016/j.ymben.2018.05.011 PubMed 29807110