dCas9-10xSunTag(22aa)
(Plasmid
#215745)
-
PurposeExpresses dCas9 with 10 GCN4 epitopes separated by 22 amino acid linkers
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 215745 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAG
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedCas9-10xSunTag
- Promoter chicken beta-actin promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer GGTTCGGCTTCTGGCGTGTGACC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bypCAG-dCas9-5xPlat2AflD was a gift from Izuho Hatada (Addgene plasmid #82560)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
dCas9-10xSunTag(22aa) was a gift from Albert Jeltsch (Addgene plasmid # 215745 ; http://n2t.net/addgene:215745 ; RRID:Addgene_215745) -
For your References section:
Modular dual-color BiAD sensors for locus-specific readout of epigenome modifications in single cells. Kohler AR, Hausser J, Harsch A, Bernhardt S, Haussermann L, Brenner LM, Lungu C, Olayioye MA, Bashtrykov P, Jeltsch A. Cell Rep Methods. 2024 Mar 26:100739. doi: 10.1016/j.crmeth.2024.100739. 10.1016/j.crmeth.2024.100739 PubMed 38554702