2xHP1bCD_W42A-IFP2.0C
(Plasmid
#215751)
-
PurposeExpresses binding-deficient W42A mutant of 2xHP1beta chromo domain fused to C-terminal part of IFP2.0 as negative control for H3K9me2/3 detection in BiAD sensors
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 215751 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name2xHP1bCD_W42A-IFP2.0C
-
SpeciesM. musculus (mouse)
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byHP1bCD W42A was taken from Addgene Plasmid #191399. IFP2.0-C1 was a gift from Michael Davidson & Xiaokun Shu 24 (Addgene plasmid # 54784; RRID:Addgene_54784)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
2xHP1bCD_W42A-IFP2.0C was a gift from Albert Jeltsch (Addgene plasmid # 215751 ; http://n2t.net/addgene:215751 ; RRID:Addgene_215751) -
For your References section:
Modular dual-color BiAD sensors for locus-specific readout of epigenome modifications in single cells. Kohler AR, Hausser J, Harsch A, Bernhardt S, Haussermann L, Brenner LM, Lungu C, Olayioye MA, Bashtrykov P, Jeltsch A. Cell Rep Methods. 2024 Mar 26:100739. doi: 10.1016/j.crmeth.2024.100739. 10.1016/j.crmeth.2024.100739 PubMed 38554702