-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 21604 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBluescript SK(-)
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 3415
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUAS-hsp70 luciferase
-
Insert Size (bp)1977
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer TCCCAGTCACGACGTTGTAAAACGACGGCC
- 3′ sequencing primer CACACAGGAAACAGCTATGACCATGATTAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUAS-Luc was a gift from Takahiro Kusakabe (Addgene plasmid # 21604 ; http://n2t.net/addgene:21604 ; RRID:Addgene_21604) -
For your References section:
Analysis of protein interactions with two-hybrid system in cultured insect cells. Mon H, Sugahara R, Hong SM, Lee JM, Kamachi Y, Kawaguchi Y, Kusakabe T. Anal Biochem. 2009 Sep 15;392(2):180-2. doi: 10.1016/j.ab.2009.05.033. 10.1016/j.ab.2009.05.033 PubMed 19481053