pGL3-RANGAP.C-linker.miniIAA7.3xFlag.P2A.BSD
(Plasmid
#216248)
-
PurposeHDR template to tag endogenous human RANGAP1 C-terminus with miniIAA7.3xFlag.P2A.BSD
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 216248 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGL3-Basic
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 2000
- Total vector size (bp) 4146
-
Vector typeMammalian Expression, CRISPR, TALEN ; HDR template
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHDR template for human RANGAP1
-
Alt nameRANGAP1
-
SpeciesH. sapiens (human)
-
GenBank IDNM_001278651.2
-
Tag
/ Fusion Protein
- miniIAA7.3xFlag.P2A.BSD (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer caaataggggttccgcgcac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3-RANGAP.C-linker.miniIAA7.3xFlag.P2A.BSD was a gift from Elina Ikonen (Addgene plasmid # 216248 ; http://n2t.net/addgene:216248 ; RRID:Addgene_216248) -
For your References section:
HiHo-AID2: boosting homozygous knock-in efficiency enables robust generation of human auxin-inducible degron cells. Li S, Wang Y, van der Stoel M, Zhou X, Madhusudan S, Kanerva K, Nguyen VD, Eskici N, Olkkonen VM, Zhou Y, Raivio T, Ikonen E. Genome Biol. 2024; 25, 58. 10.1186/s13059-024-03187-w 10.1186/s13059-024-03187-w