pGL3-sgSEC61B.N1-CAG-Cas9-T2A-mCherry-P2A-Puro
(Plasmid
#216251)
-
PurposeExpress Cas9 with CAG promoter to improve the expression in hES cells and sgSEC61B.N1 to tag endogenous SEC61B N-terminus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 216251 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGL3-basic
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 2000
- Total vector size (bp) 10389
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9 and sgSEC61B.N1
-
Alt nameSEC61B
-
SpeciesH. sapiens (human)
-
Insert Size (bp)19
-
GenBank IDNM_006808.3
-
Entrez GeneSEC61B
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site BstBI (unknown if destroyed)
- 5′ sequencing primer GACTATCATATGCTTACCGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3-sgSEC61B.N1-CAG-Cas9-T2A-mCherry-P2A-Puro was a gift from Elina Ikonen (Addgene plasmid # 216251 ; http://n2t.net/addgene:216251 ; RRID:Addgene_216251) -
For your References section:
HiHo-AID2: boosting homozygous knock-in efficiency enables robust generation of human auxin-inducible degron cells. Li S, Wang Y, van der Stoel M, Zhou X, Madhusudan S, Kanerva K, Nguyen VD, Eskici N, Olkkonen VM, Zhou Y, Raivio T, Ikonen E. Genome Biol. 2024 Feb 26;25(1):58. doi: 10.1186/s13059-024-03187-w. 10.1186/s13059-024-03187-w PubMed 38409044