pAAV-hSyn-DIO-NES-jRGECO1a-WPRE
(Plasmid
#216276)
-
PurposeAAV vector with hSynapsin promoter and DIO Lox sites for Cre-On expression of red fluorescent calcium indicator jRGECO1a
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 216276 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-hSyn-DIO-insert-WPRE-hGHpA
-
Backbone manufacturerBryan Roth
- Backbone size w/o insert (bp) 4805
- Total vector size (bp) 6499
-
Vector typeAAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNES-jRGECO1a
-
Alt nameNES-R-GECO1.0 variant 1670
-
Insert Size (bp)1413
- Promoter human synapsin 1 (hSyn)
-
Tags
/ Fusion Proteins
- 6XHIS (N terminal on insert)
- Xpress (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer hSyn-Fwd, TCGTGTCGTGCCTGAGAGCG
- 3′ sequencing primer WPRE-Rev, GCAGCGTATCCACATAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byVivek Jayaraman, Ph.D., Douglas S. Kim, Ph.D., Loren L. Looger, Ph.D., Karel Svoboda, Ph.D. from the GENIE Project, Janelia Research Campus, Howard Hughes Medical Institute (Addgene plasmid 61563). Sensitive red protein calcium indicators for imaging neural activity. Dana H, Mohar B, Sun Y, Narayan S, Gordus A, Hasseman JP, Tsegaye G, Holt GT, Hu A, Walpita D, Patel R, Macklin JJ, Bargmann CI, Ahrens MB, Schreiter ER, Jayaraman V, Looger LL, Svoboda K, Kim DS. Elife. 2016 Mar 24;5. pii: e12727. doi: 10.7554/eLife.12727. 10.7554/eLife.12727 PubMed 27011354.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-DIO-NES-jRGECO1a-WPRE was a gift from Guohong Cui (Addgene plasmid # 216276 ; http://n2t.net/addgene:216276 ; RRID:Addgene_216276) -
For your References section:
Spectrally Resolved Fiber Photometry for Multi-component Analysis of Brain Circuits. Meng C, Zhou J, Papaneri A, Peddada T, Xu K, Cui G. Neuron. 2018 May 16;98(4):707-717.e4. doi: 10.1016/j.neuron.2018.04.012. Epub 2018 May 3. 10.1016/j.neuron.2018.04.012 PubMed 29731250