Skip to main content

pD441-H6-SUMO-HyPerFLEX
(Plasmid #216676)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 216676 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pD441
  • Backbone size w/o insert (bp) 3972
  • Total vector size (bp) 5370
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    HyPerFLEX
  • Alt name
    OxyR fused with circularly permuted Y-FAST
  • Species
    Synthetic; N. meningitidis OxyR
  • Insert Size (bp)
    1398
  • Promoter T5
  • Tag / Fusion Protein
    • 6xHis-SUMO (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AGCGCTCACAATTCCACAAC
  • 3′ sequencing primer GGGGGTGTCGCCCTTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pD441-H6-SUMO-HyPerFLEX was a gift from Joris Messens (Addgene plasmid # 216676 ; http://n2t.net/addgene:216676 ; RRID:Addgene_216676)
  • For your References section:

    A color-tailored fluorogenic sensor for hydrogen peroxide. Potekhina ES, Bass DI, Ezerina D, Fleckenstein DD, Chebotarev AS, Sysoeva VA, Maltsev DI, Pak VV, Moshchenko AA, Sokolov AI, Myasnyanko IN, Baranov MS, Fedotov AB, Zheltikov AM, Lanin AA, Messens J, Belousov VV. Nat Chem Biol. 2025 Oct 16. doi: 10.1038/s41589-025-02036-6. 10.1038/s41589-025-02036-6 PubMed 41102408