pD441-H6-SUMO-HyPerFLEX
(Plasmid
#216676)
-
PurposePlasmid with cleavable His-tag for expression of the HyPer-FLEX sensor for hydrogen peroxide in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 216676 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepD441
- Backbone size w/o insert (bp) 3972
- Total vector size (bp) 5370
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHyPerFLEX
-
Alt nameOxyR fused with circularly permuted Y-FAST
-
SpeciesSynthetic; N. meningitidis OxyR
-
Insert Size (bp)1398
- Promoter T5
-
Tag
/ Fusion Protein
- 6xHis-SUMO (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGCGCTCACAATTCCACAAC
- 3′ sequencing primer GGGGGTGTCGCCCTTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pD441-H6-SUMO-HyPerFLEX was a gift from Joris Messens (Addgene plasmid # 216676 ; http://n2t.net/addgene:216676 ; RRID:Addgene_216676) -
For your References section:
A color-tailored fluorogenic sensor for hydrogen peroxide. Potekhina ES, Bass DI, Ezerina D, Fleckenstein DD, Chebotarev AS, Sysoeva VA, Maltsev DI, Pak VV, Moshchenko AA, Sokolov AI, Myasnyanko IN, Baranov MS, Fedotov AB, Zheltikov AM, Lanin AA, Messens J, Belousov VV. Nat Chem Biol. 2025 Oct 16. doi: 10.1038/s41589-025-02036-6. 10.1038/s41589-025-02036-6 PubMed 41102408