T7_CC_Vpx-SIV_WPRE_IVT_Template
(Plasmid
#216792)
-
PurposeTemplate for in vitro transcription of Vpx (SIV).
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 216792 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBR322
- Total vector size (bp) 4179
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVpx (SIV)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)342
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CAGGAAACAGCTATGAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Derived from pT7-PEmax for IVT (Addgene 178113). The template must be amplified by PCR using a forward primer designed to rectify a T7 promoter inactivating mutation and a reverse primer that appends a poly(A) tail to the 3’ UTR. The vector has been designed for co-transcriptional capping with CleanCap AG.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
T7_CC_Vpx-SIV_WPRE_IVT_Template was a gift from Daniel Bauer (Addgene plasmid # 216792 ; http://n2t.net/addgene:216792 ; RRID:Addgene_216792) -
For your References section:
Enhancing prime editing in hematopoietic stem and progenitor cells by modulating nucleotide metabolism. Levesque S, Cosentino A, Verma A, Genovese P, Bauer DE. Nat Biotechnol. 2024 May 28. doi: 10.1038/s41587-024-02266-4. 10.1038/s41587-024-02266-4 PubMed 38806736