Skip to main content
Addgene

T7_CC_Vpx-SIV_WPRE_IVT_Template
(Plasmid #216792)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 216792 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBR322
  • Total vector size (bp) 4179
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Vpx (SIV)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    342
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CAGGAAACAGCTATGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Derived from pT7-PEmax for IVT (Addgene 178113). The template must be amplified by PCR using a forward primer designed to rectify a T7 promoter inactivating mutation and a reverse primer that appends a poly(A) tail to the 3’ UTR. The vector has been designed for co-transcriptional capping with CleanCap AG.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    T7_CC_Vpx-SIV_WPRE_IVT_Template was a gift from Daniel Bauer (Addgene plasmid # 216792 ; http://n2t.net/addgene:216792 ; RRID:Addgene_216792)
  • For your References section:

    Enhancing prime editing in hematopoietic stem and progenitor cells by modulating nucleotide metabolism. Levesque S, Cosentino A, Verma A, Genovese P, Bauer DE. Nat Biotechnol. 2024 May 28. doi: 10.1038/s41587-024-02266-4. 10.1038/s41587-024-02266-4 PubMed 38806736