MAP4K3-GFP d344-873
(Plasmid
#21732)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 21732 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMAP4K3
-
Alt nameGLK
-
Alt nameMAPKKKK3
-
Alt nameRAB8IPL1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1032
-
MutationDeletion of the carboxy-terminus, amino-acids 344 to 873
-
GenBank IDBC071579
-
Entrez GeneMAP4K3 (a.k.a. GLK, MAPKKKK3, MEKKK 3, MEKKK3, RAB8IPL1)
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer CMV forward (CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer EGFP-N (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MAP4K3-GFP d344-873 was a gift from L. Miguel Martins (Addgene plasmid # 21732 ; http://n2t.net/addgene:21732 ; RRID:Addgene_21732) -
For your References section:
MAP4K3 modulates cell death via the post-transcriptional regulation of BH3-only proteins. Lam D, Dickens D, Reid EB, Loh SH, Moisoi N, Martins LM. Proc Natl Acad Sci U S A. 2009 Jul 21;106(29):11978-83. doi: 10.1073/pnas.0900608106. Epub 2009 Jul 8. 10.1073/pnas.0900608106 PubMed 19587239