pIDTSmart-CMV-PLRS1
(Plasmid
#217365)
-
PurposeExpression of previously developed E. coli leucyl aminoacyl-tRNA synthesis variant that is "polyspecific"
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 217365 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepIDT-Smart
- Backbone size w/o insert (bp) 2302
- Total vector size (bp) 5558
-
Modifications to backboneintroduced CMV-PLRS1 mutant
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameleucyl-tRNA synthetase polyspecific mutant
-
Alt nameLeuRS
-
Alt namePLRS1
-
Alt namepolyLeuRS
-
SpeciesE. coli
-
Insert Size (bp)3256
-
MutationM40I, T252A, Y499I, Y527A, H529G
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AvrII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GCCGTAAGATCACGGGTCGCAG
- 3′ sequencing primer CACGGGGGAGGGGCAAAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIDTSmart-CMV-PLRS1 was a gift from Abhishek Chatterjee (Addgene plasmid # 217365 ; http://n2t.net/addgene:217365 ; RRID:Addgene_217365) -
For your References section:
Directed Evolution of a Bacterial Leucyl tRNA in Mammalian Cells for Enhanced Noncanonical Amino Acid Mutagenesis. Huang RL, Jewel D, Kelemen RE, Pham Q, Yared TJ, Wang S, Singha Roy SJ, Huang Z, Levinson SD, Sundaresh B, Miranda SE, van Opijnen T, Chatterjee A. ACS Synth Biol. 2024 Jul 19;13(7):2141-2149. doi: 10.1021/acssynbio.4c00196. Epub 2024 Jun 21. 10.1021/acssynbio.4c00196 PubMed 38904157