Skip to main content
Addgene

pIDTSmart-CMV-PLRS1
(Plasmid #217365)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 217365 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pIDT-Smart
  • Backbone size w/o insert (bp) 2302
  • Total vector size (bp) 5558
  • Modifications to backbone
    introduced CMV-PLRS1 mutant
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    leucyl-tRNA synthetase polyspecific mutant
  • Alt name
    LeuRS
  • Alt name
    PLRS1
  • Alt name
    polyLeuRS
  • Species
    E. coli
  • Insert Size (bp)
    3256
  • Mutation
    M40I, T252A, Y499I, Y527A, H529G
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AvrII (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GCCGTAAGATCACGGGTCGCAG
  • 3′ sequencing primer CACGGGGGAGGGGCAAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIDTSmart-CMV-PLRS1 was a gift from Abhishek Chatterjee (Addgene plasmid # 217365 ; http://n2t.net/addgene:217365 ; RRID:Addgene_217365)
  • For your References section:

    Directed Evolution of a Bacterial Leucyl tRNA in Mammalian Cells for Enhanced Noncanonical Amino Acid Mutagenesis. Huang RL, Jewel D, Kelemen RE, Pham Q, Yared TJ, Wang S, Singha Roy SJ, Huang Z, Levinson SD, Sundaresh B, Miranda SE, van Opijnen T, Chatterjee A. ACS Synth Biol. 2024 Jul 19;13(7):2141-2149. doi: 10.1021/acssynbio.4c00196. Epub 2024 Jun 21. 10.1021/acssynbio.4c00196 PubMed 38904157