pAAV-hSyn-frt-DIO-hM3D(Gq)-mCherry
(Plasmid
#217397)
-
PurposeExpresses the hM3D(Gq) excitatory DREADD fused to mCherry, in a Cre-ON and FLP-OFF dependent manner, under the control of hSyn promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 217397 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4916
- Total vector size (bp) 7431
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehM3D(Gq)-mCherry
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2508
- Promoter human Synapsin 1
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Asc I (not destroyed)
- 3′ cloning site Nhe I (not destroyed)
- 5′ sequencing primer tcgtgtcgtgcctgagagcg
- 3′ sequencing primer GCATTAAAGCAGCGTATCCACATAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byInsert from Addgene Plasmid #44361
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Created by inserting hM3D(Gq)-mCherry in the pAAV-hSyn-frt-DIO-hM4D(Gi)-mCherry plasmid from this paper (Addgene Plasmid #XXXXX)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-frt-DIO-hM3D(Gq)-mCherry was a gift from Oscar Marin (Addgene plasmid # 217397 ; http://n2t.net/addgene:217397 ; RRID:Addgene_217397)