Skip to main content

pmEGFP-N1
(Plasmid #217486)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 217486 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-N1
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mEGFP
  • Species
    Aequorea victoria
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TTTAGTGAACCGTCAGATC
  • 3′ sequencing primer TTTAAAGCAAGTAAAACCTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmEGFP-N1 was a gift from Bertrand Collet (Addgene plasmid # 217486 ; http://n2t.net/addgene:217486 ; RRID:Addgene_217486)
  • For your References section:

    Unexpected regulatory functions of cyprinid Viperin on inflammation and metabolism. Chaumont L, Jouneau L, Huetz F, van Muilekom DR, Peruzzi M, Raffy C, Le Hir J, Minke J, Boudinot P, Collet B. BMC Genomics. 2024 Jun 29;25(1):650. doi: 10.1186/s12864-024-10566-x. 10.1186/s12864-024-10566-x PubMed 38951796