Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

MS-1 magA
(Plasmid #21751)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 21751 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCR2.1
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 3900
  • Vector type
    cloning

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    magA
  • Species
    M. magnetotacticum
  • Insert Size (bp)
    1300
  • GenBank ID
    AF257521
  • Entrez Gene
    magA

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ cloning site TA (destroyed during cloning)
  • 3′ cloning site TA (destroyed during cloning)
  • 5′ sequencing primer GAAGACGGCCATCTTCACCA
  • 3′ sequencing primer TTCTTCCAGATGAACTTGAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The sequence inserted into the pCR2.1 vector is larger than just the magA gene. The magA gene is preceded by 373 bp of genomic DNA and followed by 30 bp of genomic DNA. The gene contains 2 amino acid substitutions - S94L and P390S.

The cloned gene was used primarily as a probe. Also see Zurkiya et al. Magn Reson Med. 2008 Jun;59(6):1225-31.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MS-1 magA was a gift from Elliot Meyerowitz (Addgene plasmid # 21751 ; http://n2t.net/addgene:21751 ; RRID:Addgene_21751)
  • For your References section:

    Physical and genetic characterization of the genome of Magnetospirillum magnetotacticum, strain MS-1. Bertani LE, Weko J, Phillips KV, Gray RF, Kirschvink JL. Gene. 2001 Feb 21. 264(2):257-63. 10.1016/S0378-1119(01)00331-6 PubMed 11250081