Skip to main content

RepairTemplate_Smc4-mAID-HaloTAG
(Plasmid #217658)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 217658 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCR2.1
  • Backbone size w/o insert (bp) 3913
  • Total vector size (bp) 6832
  • Modifications to backbone
    The backbone was digested with EcoRV. Insert ordered as gBlock and blunt-end cloned into vector
  • Vector type
    Mammalian Expression, Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Kanamycin, 100 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SMC4-mAID-HaloTag
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2918
  • Entrez Gene
    SMC4 (a.k.a. CAP-C, CAPC, SMC-4, SMC4L1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (destroyed during cloning)
  • 3′ cloning site None (unknown if destroyed)
  • 5′ sequencing primer CAGGAAACAGCTATGAC
  • 3′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    RepairTemplate_Smc4-mAID-HaloTAG was a gift from Daniel Gerlich (Addgene plasmid # 217658 ; http://n2t.net/addgene:217658 ; RRID:Addgene_217658)
  • For your References section:

    Cohesin-mediated DNA loop extrusion resolves sister chromatids in G2 phase. Batty P, Langer CC, Takacs Z, Tang W, Blaukopf C, Peters JM, Gerlich DW. EMBO J. 2023 Aug 15;42(16):e113475. doi: 10.15252/embj.2023113475. Epub 2023 Jun 26. 10.15252/embj.2023113475 PubMed 37357575