AAVS1_Cas9-hGem_gRNA2
(Plasmid
#217659)
-
Purposeexpresses Cas9-hGem and guideRNA targeting the human AAVS1 safe harbour locus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 217659 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepX330-U6-Chimeric_BB-CBh-hSpCas9-hGem-Bpil-P2A-mCherry
- Backbone size w/o insert (bp) 9643
- Total vector size (bp) 9646
-
Vector typeMammalian Expression, Bacterial Expression, CRISPR
-
Selectable markersmCherry
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA2 targeting the human AAVS1 safe harbour locus
-
gRNA/shRNA sequenceUnspecified
-
SpeciesH. sapiens (human)
-
Insert Size (bp)19
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BpiI (destroyed during cloning)
- 3′ cloning site BpiI (destroyed during cloning)
- 5′ sequencing primer GACTATCATATGCTTACCGT
- 3′ sequencing primer GATGGGGAGAGTGAAGCAGAAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1_Cas9-hGem_gRNA2 was a gift from Daniel Gerlich (Addgene plasmid # 217659 ; http://n2t.net/addgene:217659 ; RRID:Addgene_217659) -
For your References section:
Cohesin-mediated DNA loop extrusion resolves sister chromatids in G2 phase. Batty P, Langer CC, Takacs Z, Tang W, Blaukopf C, Peters JM, Gerlich DW. EMBO J. 2023 Aug 15;42(16):e113475. doi: 10.15252/embj.2023113475. Epub 2023 Jun 26. 10.15252/embj.2023113475 PubMed 37357575