Skip to main content

hNTa2-qgRNA-pYJA5
(Plasmid #217780)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 217780 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pYJA5
  • Backbone manufacturer
    Adriano Aguzzi (Addgene #217778)
  • Backbone size w/o insert (bp) 5500
  • Total vector size (bp) 9106
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR, Synthetic Biology
  • Selectable markers
    Puromycin ; TagBFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Trimethoprim, 15 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    The NEB stable competent bacteria strain has a resistance to tetracycline, so we grow the bacteria transformed with our plasmid with both trimethoprim (15ug/ml) and tetracycline (15ug/ml) using the Terrific Broth medium (https://openwetware.org/wiki/Terrific_Broth) for two overnights at 30 °C. LB medium could also be used but with a lower yield.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Quadruple sgRNA-expression cassette for nontargeting control for gene activation and epigenetic silencing
  • gRNA/shRNA sequence
    sg1: gggagtgtgtccgagccact; sg2: actgcggagcgcccaatatc; sg3: gcaacggcgattctcggcat; gggatgcgtcttgctaaacc
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1800
  • Promoter human U6, mouse U6, human H1, human 7SK

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGGAGCCGGTTGGCGCCTAC
  • 3′ sequencing primer AGTACCGGGCCCTACGCGTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hNTa2-qgRNA-pYJA5 was a gift from Adriano Aguzzi (Addgene plasmid # 217780 ; http://n2t.net/addgene:217780 ; RRID:Addgene_217780)
  • For your References section:

    Arrayed CRISPR libraries for the genome-wide activation, deletion and silencing of human protein-coding genes. Yin JA, Frick L, Scheidmann MC, Liu T, Trevisan C, Dhingra A, Spinelli A, Wu Y, Yao L, Vena DL, Knapp B, Guo J, De Cecco E, Ging K, Armani A, Oakeley EJ, Nigsch F, Jenzer J, Haegele J, Pikusa M, Tager J, Rodriguez-Nieto S, Bouris V, Ribeiro R, Baroni F, Bedi MS, Berry S, Losa M, Hornemann S, Kampmann M, Pelkmans L, Hoepfner D, Heutink P, Aguzzi A. Nat Biomed Eng. 2024 Dec 4. doi: 10.1038/s41551-024-01278-4. 10.1038/s41551-024-01278-4 PubMed 39633028