Skip to main content
Addgene

mouse b8 full length
(Plasmid #217817)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 217817 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pD2529 CAG
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ITGB8
  • Alt name
    Integrin beta 8
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Itgb8 (a.k.a. 4832412O06Rik)
  • Promoter CAG
  • Tag / Fusion Protein
    • P2A-mCherry (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TTTCCTACAGCTCCTGGGCAAC
  • 3′ sequencing primer CATGTGCACCTTGAAGCG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mouse b8 full length was a gift from Timothy Springer (Addgene plasmid # 217817 ; http://n2t.net/addgene:217817 ; RRID:Addgene_217817)
  • For your References section:

    Synthetic integrin antibodies discovered by yeast display reveal αV subunit pairing preferences with β subunits. Yuxin Hao, Jiabin Yan, Courtney Fraser, Aiping Jiang, Murali Anuganti, Roushu Zhang, Kenneth Lloyd, Joseph Jardine, Jessica Coppola, Rob Meijers, Jing Li, Timothy A.. bioRxiv 2024.01.26.577394 10.1101/2024.01.26.577394