CKII-NPTX1-pH
(Plasmid
#217974)
-
PurposeExpression of NPTX1-pHluorin for optical monitoring of presynaptic release in neurons
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 217974 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneFCK(1.3)GW
- Backbone size w/o insert (bp) 9227
- Total vector size (bp) 11294
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBleomycin resistance
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNeuronal Pentraxin 1-pHluorin
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)2067
-
GenBank IDNM_266777
- Promoter CaMKIIa
-
Tag
/ Fusion Protein
- pHluorin
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGAGTGGCCCCTAGTTCTGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.04.19.590083 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CKII-NPTX1-pH was a gift from Jaime de Juan-Sanz (Addgene plasmid # 217974 ; http://n2t.net/addgene:217974 ; RRID:Addgene_217974) -
For your References section:
Monitoring of activity-driven trafficking of endogenous synaptic proteins through proximity labeling. Pascual-Caro C, de Juan-Sanz J. PLoS Biol. 2024 Oct 28;22(10):e3002860. doi: 10.1371/journal.pbio.3002860. eCollection 2024 Oct. 10.1371/journal.pbio.3002860 PubMed 39466808