pOT_7-lenti-EFS-SS1-BBz-2A-puro
(Plasmid
#217990)
-
PurposeExpresses anti-Mesothelin CAR (with 4-1BB signaling domain) linked to puromycin resistance via P2A for lentiviral delivery.
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 217990 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonelentiCRISPR v2
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSS1-BBz CAR
-
SpeciesH. sapiens (human), Synthetic
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGGGTTTGCCGCCAGAACACAGGACC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.11.27.625752 for bioRxiv preprint.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOT_7-lenti-EFS-SS1-BBz-2A-puro was a gift from Neville Sanjana (Addgene plasmid # 217990 ; http://n2t.net/addgene:217990 ; RRID:Addgene_217990) -
For your References section:
Paired CRISPR screens to map gene regulation in cis and trans. Xue X, Gajic ZZ, Caragine CM, Legut M, Walker C, Kim JYS, Wang X, Yan RE, Wessels HH, Lu C, Bapodra N, Gursoy G, Sanjana NE. bioRxiv [Preprint]. 2024 Nov 27:2024.11.27.625752. doi: 10.1101/2024.11.27.625752. 10.1101/2024.11.27.625752 PubMed 39651170
Map uploaded by the depositor.
