peSCBE3-NG-HF1-Hypa
(Plasmid
#218166)
-
PurposeThis plasmid harbors the base editor eSCBE3-NG-HF1-Hypa along with an sgRNA cloning cassette, facilitating high-efficiency and high-fidelity base editing at targets bearing NG PAM in Streptomyces.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 218166 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSCBE3
-
Backbone manufacturerJian Wang
- Backbone size w/o insert (bp) 8525
-
Vector typeBacterial Expression, CRISPR ; sgRNA transcription
Growth in Bacteria
-
Bacterial Resistance(s)Apramycin, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameescbe3-NG-HF1-Hypa
-
SpeciesS. coelicolor (bacteria)
-
Insert Size (bp)5106
-
MutationMutation in the portion of deaminase hAPOBEC3A : Y130F, mutations in the portion of SpCas9 : D10A / N497A / R661A / N692A / M694A / Q695A / H698A / Q926A / L1111R / D1135V / G1218R / E1219F / A1322R / R1335V / T1337R.
- Promoter rpsL promoter
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CCTGCTCTCACGCAACGTCTAC
- 3′ sequencing primer ATCCGCTTGCCCTCATCTGT
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namea programmable sgRNA cloning cassette
-
SpeciesSynthetic
Resource Information
-
A portion of this plasmid was derived from a plasmid made byOriginal clone
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Another insert : a programmable sgRNA cloning cassette
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
peSCBE3-NG-HF1-Hypa was a gift from Yuhui Sun (Addgene plasmid # 218166 ; http://n2t.net/addgene:218166 ; RRID:Addgene_218166) -
For your References section:
Engineered cytosine base editor enabling broad-scope and high-fidelity gene editing in Streptomyces. Wang J, Wang K, Deng Z, Zhong Z, Sun G, Mei Q, Zhou F, Deng Z, Sun Y. Nat Commun. 2024 Jul 7;15(1):5687. doi: 10.1038/s41467-024-49987-3. 10.1038/s41467-024-49987-3 PubMed 38971862