pXDC61
(Plasmid
#21841)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 21841 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMMB207C
- Backbone size w/o insert (bp) 9024
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameblaM
-
SpeciesE. coli
-
Insert Size (bp)845
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GAGCTGTTGACAATTAATCATCGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXDC61 was a gift from Howard Shuman (Addgene plasmid # 21841 ; http://n2t.net/addgene:21841 ; RRID:Addgene_21841) -
For your References section:
Chemical genetics reveals bacterial and host cell functions critical for type IV effector translocation by Legionella pneumophila. Charpentier X, Gabay JE, Reyes M, Zhu JW, Weiss A, Shuman HA. PLoS Pathog. 2009 Jul . 5(7):e1000501. 10.1371/journal.ppat.1000501 PubMed 19578436