pON.mCherry
(Plasmid #84821)

• Purpose: Constitutive Expression plasmid with mCherry fluorescent protein
• Depositing Lab: Howard Shuman
• Publication: Gebhardt et al PLoS One. 2017 Mar 3;12(3):e0173116. doi: 10.1371/journal.pone.0173116. eCollection 2017.

Backbone

• Vector backbone: pMMB207c
• Backbone size w/o insert (bp): 9077
• Total vector size (bp): 9785
• Modifications to backbone: The lac repressor binding site (operator) was mutated, likely abrogating binding of the repressor to the DNA and resulting in constitutive expression from the Lac promoter harbored by the plasmid.
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: mCherry
• Insert Size (bp): 708
• Promoter: Tac Promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI or NdeI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: TCGGCTCGTATAATGTGTGGAATTGTG
• 3′ sequencing primer: CAGACCGCTTCTGCGTTCTGAT

Resource Information

• Supplemental Documents:
  • pONmCherry.gb
• A portion of this plasmid was derived from a plasmid made by: The mCherry fragment was sub-cloned from plasmid pXDC50, created by Xavier Charpentier
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry