pCAG-EGFP-N-IFT80
(Plasmid
#218731)
-
PurposeExpresses C-terminally EGFP-tagged IFT80 in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 218731 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAG-EGFP-N
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 6851
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIFT80
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2334
-
Entrez GeneIFT80 (a.k.a. ATD2, SRTD2, WDR56)
- Promoter CAG
-
Tag
/ Fusion Protein
- EGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII/BamHI (destroyed during cloning)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GCTTCTGGCGTGTGACCG
- 3′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-EGFP-N-IFT80 was a gift from Kazuhisa Nakayama (Addgene plasmid # 218731 ; http://n2t.net/addgene:218731 ; RRID:Addgene_218731)