pBEVY-4420-mCherry
(Plasmid
#218828)
-
PurposeYeast surface display of an anti-fluorescene scFv and intracellular expression of mCherry
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 218828 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBEVY
-
Backbone manufacturerCharles Miller (Tulane University)
- Backbone size w/o insert (bp) 7050
- Total vector size (bp) 7815
-
Vector typeYeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name4-4-20 scFv
-
Alt nameanti-fluorescein
-
SpeciesM. musculus (mouse)
- Promoter GAL1-10
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer cctctatactttaacgtcaaggag (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBEVY-4420-mCherry was a gift from Yongku Cho (Addgene plasmid # 218828 ; http://n2t.net/addgene:218828 ; RRID:Addgene_218828) -
For your References section:
Yeast biopanning against site-specific phosphorylations in tau. Arbaciauskaite M, Pirhanov A, Ammermann E, Lei Y, Cho YK. Protein Eng Des Sel. 2023 Jan 21;36:gzad005. doi: 10.1093/protein/gzad005. 10.1093/protein/gzad005 PubMed 37294629