pSicoR-mCh-Chd1i4
(Plasmid
#21908)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 21908 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSicoR
- Backbone size w/o insert (bp) 7558
-
Vector typeMammalian Expression, Lentiviral, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameChd1-i4
-
Alt nameshRNA-i4 Chd1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)55
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HpaI (destroyed during cloning)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer cacagacttgtgggagaagc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Chd1 RNAi4 sequence - 5'-GTGCTACTACAACCATTTA
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSicoR-mCh-Chd1i4 was a gift from Miguel Ramalho-Santos (Addgene plasmid # 21908 ; http://n2t.net/addgene:21908 ; RRID:Addgene_21908) -
For your References section:
Chd1 regulates open chromatin and pluripotency of embryonic stem cells. Gaspar-Maia A, Alajem A, Polesso F, Sridharan R, Mason MJ, Heidersbach A, Ramalho-Santos J, McManus MT, Plath K, Meshorer E, Ramalho-Santos M. Nature. 2009 Aug 13;460(7257):863-8. doi: 10.1038/nature08212. Epub 2009 Jul 8. 10.1038/nature08212 PubMed 19587682