-
PurposeConstitutive expression of mChartreuse in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 219397 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepNF02
- Backbone size w/o insert (bp) 6548
- Total vector size (bp) 7265
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsUse 15µg/ml chloramphenicol
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemChartreuse
-
Alt namemCha
-
SpeciesA. victoria
-
Insert Size (bp)717
- Promoter proDp
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCACAACGGTTTCCCTCTAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNF02-mChartreuse was a gift from Christian Lesterlin (Addgene plasmid # 219397 ; http://n2t.net/addgene:219397 ; RRID:Addgene_219397) -
For your References section:
A palette of bright and photostable monomeric fluorescent proteins for bacterial time-lapse imaging. Fraikin N, Couturier A, Mercier R, Lesterlin C. Sci Adv. 2025 Apr 18;11(16):eads6201. doi: 10.1126/sciadv.ads6201. Epub 2025 Apr 16. 10.1126/sciadv.ads6201 PubMed 40238862