pAGT6471
(Plasmid
#219428)
-
PurposeModule of intronized NLS-SpCas9-NLS for N-terminal and C-terminal tag fusions (AGGT_N-SpCas9i-N_TTCG)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 219428 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAGM3955
-
Backbone manufacturerSylvestre Marillonnet
- Backbone size w/o insert (bp) 2073
- Total vector size (bp) 7864
-
Vector typeMoClo compatible Level 0 module
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAGGT_NLS-SpCas9i-NLS(no stop)_TTCG
-
Alt nameSpCas9
-
SpeciesA. thaliana (mustard weed); Streptococcus pyogenes SF370
-
Insert Size (bp)5799
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer CCTGTCGGGTTTCGCCACCTC
- 3′ sequencing primer GCCGTTACCACCGCTGCGTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAGT6471 was a gift from Tom Schreiber (Addgene plasmid # 219428 ; http://n2t.net/addgene:219428 ; RRID:Addgene_219428) -
For your References section:
Efficient scar-free knock-ins of several kilobases in plants by engineered CRISPR/Cas endonucleases. Schreiber T, Prange A, Schafer P, Iwen T, Grutzner R, Marillonnet S, Lepage A, Javelle M, Paul W, Tissier A. Mol Plant. 2024 Mar 22:S1674-2052(24)00086-8. doi: 10.1016/j.molp.2024.03.013. 10.1016/j.molp.2024.03.013 PubMed 38520090