Skip to main content

pAGT6471
(Plasmid #219428)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 219428 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAGM3955
  • Backbone manufacturer
    Sylvestre Marillonnet
  • Backbone size w/o insert (bp) 2073
  • Total vector size (bp) 7864
  • Vector type
    MoClo compatible Level 0 module

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AGGT_NLS-SpCas9i-NLS(no stop)_TTCG
  • Alt name
    SpCas9
  • Species
    A. thaliana (mustard weed); Streptococcus pyogenes SF370
  • Insert Size (bp)
    5799

Cloning Information

  • Cloning method Golden Gate
  • 5′ sequencing primer CCTGTCGGGTTTCGCCACCTC
  • 3′ sequencing primer GCCGTTACCACCGCTGCGTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAGT6471 was a gift from Tom Schreiber (Addgene plasmid # 219428 ; http://n2t.net/addgene:219428 ; RRID:Addgene_219428)
  • For your References section:

    Efficient scar-free knock-ins of several kilobases in plants by engineered CRISPR/Cas endonucleases. Schreiber T, Prange A, Schafer P, Iwen T, Grutzner R, Marillonnet S, Lepage A, Javelle M, Paul W, Tissier A. Mol Plant. 2024 Mar 22:S1674-2052(24)00086-8. doi: 10.1016/j.molp.2024.03.013. 10.1016/j.molp.2024.03.013 PubMed 38520090