pAGT9050
(Plasmid
#219429)
-
PurposePapE Exonuclease fused to linker 4LF2 as N-terminal tag module (AATG_PapE-4*LF2_AGGT)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 219429 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAGM3993
-
Backbone manufacturerSylvestre Marillonnet
- Backbone size w/o insert (bp) 2073
- Total vector size (bp) 4070
-
Vector typeMoClo compatible Level 0 module
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAATG_PapE-4xLF2_AGGT
-
Alt namePapE-4LF2
-
SpeciesSynthetic; Papiine 189 alpha Herpes Virus 2
-
Insert Size (bp)2005
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer CCTGTCGGGTTTCGCCACCTC
- 3′ sequencing primer GCCGTTACCACCGCTGCGTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAGT9050 was a gift from Tom Schreiber (Addgene plasmid # 219429 ; http://n2t.net/addgene:219429 ; RRID:Addgene_219429) -
For your References section:
Efficient scar-free knock-ins of several kilobases in plants by engineered CRISPR/Cas endonucleases. Schreiber T, Prange A, Schafer P, Iwen T, Grutzner R, Marillonnet S, Lepage A, Javelle M, Paul W, Tissier A. Mol Plant. 2024 Mar 22:S1674-2052(24)00086-8. doi: 10.1016/j.molp.2024.03.013. 10.1016/j.molp.2024.03.013 PubMed 38520090