pAGT9569
(Plasmid
#219431)
-
PurposeTranscriptional unit (MoClo-position 2): pAtRPS5a_PapE-4LF2-N-SpCas9i-N_tNOS
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 219431 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepICH47742
-
Backbone manufacturerSylvestre Marillonnet
- Backbone size w/o insert (bp) 4356
- Total vector size (bp) 14110
-
Vector typePlant Expression, CRISPR, Synthetic Biology ; MoClo compatible Level 1 module (position 2)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLB_AtRPS5a:PapE-4xLF2-NLS-SpCas9i-NLS:tNOS_RB (Position 2)
-
Alt namePapE-4LF2-Cas9
-
SpeciesA. thaliana (mustard weed), Synthetic; Papiine 189 alpha Herpes Virus 2, Streptococcus pyogenes SF370, Agrobacterium tumefaciencs
-
Insert Size (bp)10096
-
Tag
/ Fusion Protein
- PapE-4LF2 (N terminal on insert)
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer TGTTGGCTGGCTGGTGGCAGG
- 3′ sequencing primer CTCTTTTCTCTTAGGTTTACCCGCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe AtRPS5a promoter Module pJOG603 was generated by Johannes Stuttmann
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAGT9569 was a gift from Tom Schreiber (Addgene plasmid # 219431 ; http://n2t.net/addgene:219431 ; RRID:Addgene_219431) -
For your References section:
Efficient scar-free knock-ins of several kilobases in plants by engineered CRISPR/Cas endonucleases. Schreiber T, Prange A, Schafer P, Iwen T, Grutzner R, Marillonnet S, Lepage A, Javelle M, Paul W, Tissier A. Mol Plant. 2024 Mar 22:S1674-2052(24)00086-8. doi: 10.1016/j.molp.2024.03.013. 10.1016/j.molp.2024.03.013 PubMed 38520090