-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 21950 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV4
-
Backbone manufacturerAndersson,S. et al, J. Biol. Chem. 264 (14), 8222-8229 (1989)
- Backbone size w/o insert (bp) 4874
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBlaM-Vpr
-
SpeciesFusion of BlaM and HIV-1 Vpr
-
Insert Size (bp)1100
-
Entrez Genevpr (a.k.a. HIV1gp4)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer CMV forward: cgcaaatgggcggtaggcgtg
- 3′ sequencing primer hGH-pA-R
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV4-BlaM-Vpr was a gift from Warner Greene (Addgene plasmid # 21950 ; http://n2t.net/addgene:21950 ; RRID:Addgene_21950) -
For your References section:
A sensitive and specific enzyme-based assay detecting HIV-1 virion fusion in primary T lymphocytes. Cavrois M, De Noronha C, Greene WC. Nat Biotechnol. 2002 Nov . 20(11):1151-4. 10.1038/nbt745 PubMed 12355096