pLVX-EF1a-mito-mRaspberry
(Plasmid
#219568)
-
PurposeLentiviral construct expressing a mitochondria-targeted mRaspberry
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 219568 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLVX
-
Backbone manufacturerClonetech
- Backbone size w/o insert (bp) 7462
- Total vector size (bp) 8251
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMito
-
Alt nameCOX8A presequence
-
SpeciesH. sapiens (human)
-
Insert Size (bp)72
-
GenBank IDNM_004074.3
-
Entrez GeneCOX8A (a.k.a. COX, COX8, COX8-2, COX8L, MC4DN15, VIII, VIII-L)
- Promoter EF1a
-
Tag
/ Fusion Protein
- mRaspberry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI-HF (not destroyed)
- 3′ cloning site BsrgII-HF (not destroyed)
- 5′ sequencing primer GCGGCCGCATGTCCGTCCTGACGCCGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bymito-mRaspberry was amplified from Addgene plasmid #55931. The vector backbone is pLVX from clontech.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLVX-EF1a-mito-mRaspberry was a gift from Thomas Schwarz (Addgene plasmid # 219568 ; http://n2t.net/addgene:219568 ; RRID:Addgene_219568) -
For your References section:
Energy stress activates AMPK to arrest mitochondria via phosphorylation of TRAK1. Falk JE, Henke T, Gowrisankaran S, Wanderoy S, Basu H, Greally S, Steen J, Schwarz TL. J Cell Biol. 2026 Apr 6;225(4):e202501023. doi: 10.1083/jcb.202501023. Epub 2026 Jan 30. 10.1083/jcb.202501023 PubMed 41615403