mCherry-ActA-IRES-puromycin-pLVx-EF1a
(Plasmid #177433)

• Purpose: To express mCherry fused to ActA mitochondria targeting sequence. Lentiviral vector used to make cell lines expressing this mitochondria landmark.
• Depositing Lab: David Andrews
• Publication: David Andrews Lab plasmids (unpublished)

Backbone

• Vector backbone: pLVX-EF1a-IRES-Puromycin
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ActA tail anchor
• Alt name: mCherry-ActA, Ch-ActA, ChActA
• Species: Listeria monocytogenes
• Entrez Gene: actA (a.k.a. lmo0204)
• Promoter: EF1a
• Tag / Fusion Protein:
  • mCherry (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: aagcgcgatcacatggtcctg

Resource Information

• Supplemental Documents:
  • mCherry-ActA-IRES-Puromycin-plVx-EF1a.gbk
• A portion of this plasmid was derived from a plasmid made by: See gene entry for "actin assembly-inducing protein ActA" (NCBI Reference Sequence: WP_110138194.1). Here we have used only the C-terminal tail anchor sequence of this protein. mCherry sequence matches GenBank: AZP55984.1.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Infection with this plasmid will express mCherry-fused to the N-terminus of ActA tail anchor sequence: "LILAMLAIGVFSLGAFIKIIQLRKNN", which targets the mitochondrial outer membrane and signal correlates with mitotracker Green signal in cells. There is a flexible, 7 aa linker "SGLRSRV", between mCherry and ActA.