mCherry-ActA-IRES-puromycin-pLVx-EF1a
(Plasmid
#177433)
-
PurposeTo express mCherry fused to ActA mitochondria targeting sequence. Lentiviral vector used to make cell lines expressing this mitochondria landmark.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 177433 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLVX-EF1a-IRES-Puromycin
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameActA tail anchor
-
Alt namemCherry-ActA, Ch-ActA, ChActA
-
SpeciesListeria monocytogenes
-
Entrez GeneactA (a.k.a. lmo0204)
- Promoter EF1a
-
Tag
/ Fusion Protein
- mCherry (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer aagcgcgatcacatggtcctg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bySee gene entry for "actin assembly-inducing protein ActA" (NCBI Reference Sequence: WP_110138194.1). Here we have used only the C-terminal tail anchor sequence of this protein. mCherry sequence matches GenBank: AZP55984.1.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Infection with this plasmid will express mCherry-fused to the N-terminus of ActA tail anchor sequence: "LILAMLAIGVFSLGAFIKIIQLRKNN", which targets the mitochondrial outer membrane and signal correlates with mitotracker Green signal in cells. There is a flexible, 7 aa linker "SGLRSRV", between mCherry and ActA.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mCherry-ActA-IRES-puromycin-pLVx-EF1a was a gift from David Andrews (Addgene plasmid # 177433 ; http://n2t.net/addgene:177433 ; RRID:Addgene_177433)