Skip to main content

CMV-d2eGFP-20
(Plasmid #21970)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 21970 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA5
  • Backbone size w/o insert (bp) 5000
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CMV d2eGFP miR-20 sponge
  • Insert Size (bp)
    175

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site ApaI (not destroyed)
  • 5′ sequencing primer n/a
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

miR-20 bulged Renilla luciferase reporter and CMV sponge: UACCUGCACUCGCGCACUUUA

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CMV-d2eGFP-20 was a gift from Phil Sharp (Addgene plasmid # 21970 ; http://n2t.net/addgene:21970 ; RRID:Addgene_21970)
  • For your References section:

    MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells. Ebert MS, Neilson JR, Sharp PA. Nat Methods. 2007 Sep . 4(9):721-6. 10.1038/nmeth1079 PubMed 17694064