PB-TRE-dCas9-Zim3-MeCP2
(Plasmid
#220143)
-
Purposedoxycycline-inducible dCas9-Zim3-MeCP2 expression for Epigenetic repression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 220143 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePB-Tre
- Backbone size w/o insert (bp) 7975
- Total vector size (bp) 5316
-
Vector typeMammalian Expression, CRISPR, Synthetic Biology ; Piggybac
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9-Zim3-MeCP2
- Promoter Tre-3G
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GCACAGGGATAAGCCCATCAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-TRE-dCas9-Zim3-MeCP2 was a gift from Frank Buchholz (Addgene plasmid # 220143 ; http://n2t.net/addgene:220143 ; RRID:Addgene_220143) -
For your References section:
DNA methylation-independent long-term epigenetic silencing with dCRISPR/Cas9 fusion proteins. Ding L, Schmitt LT, Brux M, Surun D, Augsburg M, Lansing F, Mircetic J, Theis M, Buchholz F. Life Sci Alliance. 2022 Mar 14;5(6). pii: 5/6/e202101321. doi: 10.26508/lsa.202101321. Print 2022 Jun. 10.26508/lsa.202101321 PubMed 35288457