pcDNA3.1-TRPV1exCellHalo
(Plasmid
#220307)
-
PurposeMammalian expression vector for a subunit of rat TRPV1 with circularly permutated HaloTag inserted between the S5 and S6 transmembrane helices
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 220307 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepcDNA3.1
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namerTRPV1exCellHalo
-
Alt nameTRPV1cpHaloTag
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)3477
-
Mutationlinker included to insert cpHaloTag (
-
Entrez GeneTrpv1 (a.k.a. TRPV1_SON, VR.5'sv, Vr1, Vr1l1)
- Promoter CMV promoter
-
Tag
/ Fusion Protein
- circularly permutated Halotag (Deo et al., Nat Chem Biol., 2021)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe rat TRPV1 was acquired from Sharona Gordon at University of Washington.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.05.09.593209 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-TRPV1exCellHalo was a gift from Eric Senning (Addgene plasmid # 220307 ; http://n2t.net/addgene:220307 ; RRID:Addgene_220307) -
For your References section:
Fluorescence labeling strategies for cell surface expression of TRPV1. Mott TM, Wulffraat GC, Eddins AJ, Mehl RA, Senning EN. J Gen Physiol. 2024 Oct 7;156(10):e202313523. doi: 10.1085/jgp.202313523. Epub 2024 Aug 20. 10.1085/jgp.202313523 PubMed 39162763