Skip to main content

pcDNA3.1-TRPV1exCellHalo
(Plasmid #220307)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 220307 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pcDNA3.1
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    rTRPV1exCellHalo
  • Alt name
    TRPV1cpHaloTag
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    3477
  • Mutation
    linker included to insert cpHaloTag (
  • Entrez Gene
    Trpv1 (a.k.a. TRPV1_SON, VR.5'sv, Vr1, Vr1l1)
  • Promoter CMV promoter
  • Tag / Fusion Protein
    • circularly permutated Halotag (Deo et al., Nat Chem Biol., 2021)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The rat TRPV1 was acquired from Sharona Gordon at University of Washington.

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.05.09.593209 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-TRPV1exCellHalo was a gift from Eric Senning (Addgene plasmid # 220307 ; http://n2t.net/addgene:220307 ; RRID:Addgene_220307)
  • For your References section:

    Fluorescence labeling strategies for cell surface expression of TRPV1. Mott TM, Wulffraat GC, Eddins AJ, Mehl RA, Senning EN. J Gen Physiol. 2024 Oct 7;156(10):e202313523. doi: 10.1085/jgp.202313523. Epub 2024 Aug 20. 10.1085/jgp.202313523 PubMed 39162763