pRRL_H1shmp53_PGK_eGFP_Teto
(Plasmid #22039)

• Depositing Lab: Didier Trono
• Publication: TRONO lab plasmids (unpublished)

Backbone

• Vector backbone: pRRL.SIN.cPPT.PGK.GFP
• Backbone size w/o insert (bp): 7600
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: HB101
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: shmp53
• Insert Size (bp): 57

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: n/a

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

shmp53 oligo sequence is: 5'-aaaaacactacaagtacatgtgtatttctcttgatacacatgtacttgtagtg

Please note that this plasmid is not hazardous to humans by itself, but virus made from the plasmid should be treated carefully. The shRNA it produces is against mouse p53 and the targeted sequence does not match with the human sequence. However since the degradation of human p53 would potentially have oncogenic consequences, viral stocks should be manipulated carefully.