pRRL_H1shmp53_PGK_eGFP_Teto
(Plasmid
#22039)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 22039 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRRL.SIN.cPPT.PGK.GFP
- Backbone size w/o insert (bp) 7600
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsHB101
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameshmp53
-
Insert Size (bp)57
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer n/a (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
shmp53 oligo sequence is: 5'-aaaaacactacaagtacatgtgtatttctcttgatacacatgtacttgtagtg
Please note that this plasmid is not hazardous to humans by itself, but virus made from the plasmid should be treated carefully. The shRNA it produces is against mouse p53 and the targeted sequence does not match with the human sequence. However since the degradation of human p53 would potentially have oncogenic consequences, viral stocks should be manipulated carefully.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRRL_H1shmp53_PGK_eGFP_Teto was a gift from Didier Trono (Addgene plasmid # 22039 ; http://n2t.net/addgene:22039 ; RRID:Addgene_22039)