pCAG-eSpCas9-2A-GFP-sgRNA-DNA-PKcs
(Plasmid
#220493)
-
PurposeTo generate DNA-PKcs KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against DNA-PKcs exon 1.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 220493 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAG-eSpCas9-2A-GFP
-
Backbone manufacturerAddgene #79145
- Backbone size w/o insert (bp) 10225
- Total vector size (bp) 10245
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA targeting DNA-PKcs (PRKDC) exon 1
-
SpeciesH. sapiens (human)
-
Entrez GenePRKDC (a.k.a. DNA-PKC, DNA-PKcs, DNAPK, DNAPKc, DNPK1, HYRC, HYRC1, IMD26, XRCC7, p350)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer SEQ-U6-F (ATGGACTATCATATGCTTACCG)
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-eSpCas9-2A-GFP-sgRNA-DNA-PKcs was a gift from Sébastien Britton (Addgene plasmid # 220493 ; http://n2t.net/addgene:220493 ; RRID:Addgene_220493) -
For your References section:
Identification of the main barriers to Ku accumulation in chromatin. Bossaert M, Moreno A, Peixoto A, Pillaire MJ, Chanut P, Frit P, Calsou P, Loparo JJ, Britton S. bioRxiv [Preprint]. 2024 Jan 4:2024.01.03.574002. doi: 10.1101/2024.01.03.574002. 10.1101/2024.01.03.574002 PubMed 38260538