pBLU-VIPR
(Plasmid
#220498)
-
Purpose(Empty Backbone) Plasmid allowing for potent induction of gRNA using blue light. The plasmid contains VPR-EL222 and the C120 response element followed by mCherry and cloning sites for ribozyme flanked gRNA (RGR).
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 220498 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSBtet-GB (Addgene #60504)
-
Vector typeMammalian Expression, CRISPR ; Transposon
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer GGTCAAGACCACCTACAAGGCCAAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://pubmed.ncbi.nlm.nih.gov/37986968/ for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBLU-VIPR was a gift from Alexander Espinosa (Addgene plasmid # 220498 ; http://n2t.net/addgene:220498 ; RRID:Addgene_220498) -
For your References section:
Light induced expression of gRNA allows for optogenetic gene editing of T lymphocytes in vivo. Pulgarin DV, Pelo N, Ferrandiz L, Trselic T, Nyberg WA, Bowlin G, Espinosa A. bioRxiv [Preprint]. 2023 Nov 10:2023.11.09.566272. doi: 10.1101/2023.11.09.566272. 10.1101/2023.11.09.566272 PubMed 37986968