LT3GEPIR-ARshRNA3
(Plasmid
#220563)
-
PurposeTo inducibly knockdown AR expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 220563 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneLT3GEPIR
-
Backbone manufacturerDr. Johannes Zuber
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAR shRNA3
-
gRNA/shRNA sequenceACCGAGGAGCTTTCCAGAATC
-
SpeciesH. sapiens (human)
-
Insert Size (bp)125
-
Entrez GeneAR (a.k.a. AIS, AR8, DHTR, HUMARA, HYSP1, KD, NR3C4, SBMA, SMAX1, TFM)
- Promoter TRE3G (TetOP) promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TGTTTGAATGAGGCTTCAGTAC
- 3′ sequencing primer CAGCGGGGCTGCTAAAGCGCATGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LT3GEPIR-ARshRNA3 was a gift from Sean Lee (Addgene plasmid # 220563 ; http://n2t.net/addgene:220563 ; RRID:Addgene_220563) -
For your References section:
Enzalutamide induces cytotoxicity in desmoplastic small round cell tumor independent of the androgen receptor. Magrath JW, Goldberg IN, Truong DD, Hartono AB, Sampath SS, Jackson CE, Ghosh A, Cardin DL, Zhang H, Ludwig JA, Lee SB. Commun Biol. 2024 Apr 4;7(1):411. doi: 10.1038/s42003-024-06003-0. 10.1038/s42003-024-06003-0 PubMed 38575753