pCB-CBEv2
(Plasmid
#221139)
-
PurposeCoxiella burnetii CRISPR-Cas9 cytosine base editing plasmid version 2 without sgRNA construct. Expresses 3xF-BE4-PpAPOBEC1(H122A).
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 221139 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMTX808
-
Backbone manufacturerMatxalen Llosa lab
- Total vector size (bp) 16524
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert name3xF-PpAPOBEC1(H122A)-Cas9n-UGI-UGI (BE4-PpAPOBEC1(H122A))
-
SpeciesSynthetic
- Promoter lacIq-Ptac
-
Tag
/ Fusion Protein
- 3xFLAG (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TTGAAAAATTGCCTACTGAGCGCTG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
RSF1010-based plasmid. Expresses 3xF-BE4-PpAPOBEC1(H122A) from lacIq-Ptac promoter. IPTG induction is required for base editing in Coxiella burnetii. Unique XhoI, NotI and SapI sites for addition of sgRNA-encoding region(s) from pHelper-CBE-sgRNA (Addgene plasmid #221137) helper plasmid derivatives. Plasmid harbors oriT, but relaxase gene mobA is interrupted by AmpR. Plasmid encodes sacB, but sacB is not required for Coxiella burnetii base editing protocol. Plasmid alias: pSAST372.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCB-CBEv2 was a gift from Craig Roy (Addgene plasmid # 221139 ; http://n2t.net/addgene:221139 ; RRID:Addgene_221139) -
For your References section:
CRISPR-Cas9-based approaches for genetic analysis and epistatic interaction studies in Coxiella burnetii. Steiner S, Roy CR. mSphere. 2024 Nov 19:e0052324. doi: 10.1128/msphere.00523-24. 10.1128/msphere.00523-24 PubMed 39560384