pSpCas9-2A-Puro-RAB7A-gRNA1 (PX459)
(Plasmid
#221551)
-
PurposeExpresses Cas9 and gRNA for disruption of Rab7A gene in human cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 221551 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSpCas9(BB)-2A-Puro (PX459) V2.0
-
Backbone manufacturerFeng Zhang (Addgene plasmid # 62988)
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA targeting human Rab7A
-
gRNA/shRNA sequenceGGTCATCCACCATCACCTCCT
-
SpeciesH. sapiens (human)
-
Entrez GeneRAB7A (a.k.a. CMT2B, PRO2706, RAB7)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (unknown if destroyed)
- 3′ cloning site BbsI (unknown if destroyed)
- 5′ sequencing primer GACTATCATATGCTTACCGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSpCas9-2A-Puro-RAB7A-gRNA1 (PX459) was a gift from Shawn Ferguson (Addgene plasmid # 221551 ; http://n2t.net/addgene:221551 ; RRID:Addgene_221551) -
For your References section:
Lysosomal TBK1 Responds to Amino Acid Availability to Relieve Rab7-Dependent mTORC1 Inhibition. Talaia G, Bentley-DeSousa A, Ferguson SM. bioRxiv [Preprint]. 2023 Dec 17:2023.12.16.571979. doi: 10.1101/2023.12.16.571979. 10.1101/2023.12.16.571979 PubMed 38168426