pMRXIP-GFP-STX17TMΔC
(Plasmid
#221737)
-
PurposeStable expression of GFP-STX17TMΔC in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 221737 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMRX-IP
-
Backbone manufacturerDr.Shoji Yamaoka of Tokyo Medical and Dental University
- Backbone size w/o insert (bp) 6137
- Total vector size (bp) 7005
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructions100 μg/mL
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSTX17
-
Alt nameSTX17TMΔC
-
SpeciesH. sapiens (human)
-
Insert Size (bp)147
-
Mutationdeleted amino acids 1-228 and 227-302
-
GenBank IDNM_017919.2
-
Entrez GeneSTX17
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCGGCGGATCTATCGATGAATTGAATTCGCTGGCAGCTCTGCCT
- 3′ sequencing primer TAGCGGCCGCTCGAGGGATCCTTAttgTATCAATTTTCCACC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMRXIP-GFP-STX17TMΔC was a gift from Noboru Mizushima (Addgene plasmid # 221737 ; http://n2t.net/addgene:221737 ; RRID:Addgene_221737) -
For your References section:
Syntaxin 17 recruitment to mature autophagosomes is temporally regulated by PI4P accumulation. Shinoda S, Sakai Y, Matsui T, Uematsu M, Koyama-Honda I, Sakamaki JI, Yamamoto H, Mizushima N. Elife. 2024 Jun 4;12:RP92189. doi: 10.7554/eLife.92189. 10.7554/eLife.92189 PubMed 38831696