Skip to main content
Addgene

pCSC-GFP-NES-EGFP
(Plasmid #221810)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 221810 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Lentiviral vector
  • Backbone size w/o insert (bp) 8456
  • Total vector size (bp) 9983
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP-NES-EGFP
  • Insert Size (bp)
    1527
  • Promoter CMV
  • Tag / Fusion Protein
    • NES (internal tag)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer agctcgtttagtgaaccgtcagatc
  • 3′ sequencing primer ctatgttgctccttttacgctatg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCSC-GFP-NES-EGFP was a gift from Baojin Ding (Addgene plasmid # 221810 ; http://n2t.net/addgene:221810 ; RRID:Addgene_221810)
  • For your References section:

    RANBP17 Overexpression Restores Nucleocytoplasmic Transport and Ameliorates Neurodevelopment in Induced DYT1 Dystonia Motor Neurons. Akter M, Cui H, Hosain MA, Liu J, Duan Y, Ding B. J Neurosci. 2024 Apr 10;44(15):e1728232024. doi: 10.1523/JNEUROSCI.1728-23.2024. 10.1523/JNEUROSCI.1728-23.2024 PubMed 38438257