Skip to main content

LHZ1494
(Plasmid #222104)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 222104 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    KmARS1/CEN5
  • Vector type
    Yeast Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    sg1RNA, sg4RNA, sg7RNA
  • gRNA/shRNA sequence
    sg1RNA: aattgggggaattataagcgt; sg4RNA: tagaaaaacagtagtggaagg; sg7RNA:gtacacagcattggaaatacc

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

sg1RNA targets position CP015059.1 (1,020,628..1,020,648) of K. marxianus ASM185444v2 genome assembly.
sg4RNA targets position CP015055.1 (601,263..601,283) of K. marxianus ASM185444v2 genome assembly.
sg7RNA targets position CP015057.1 (232,396..232,416) of K. marxianus ASM185444v2 genome assembly.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LHZ1494 was a gift from Yongming Wang (Addgene plasmid # 222104 ; http://n2t.net/addgene:222104 ; RRID:Addgene_222104)