prhaBAD-pA-Hia5
(Plasmid
#222303)
-
PurposePlasmid for rhamnose inducible expression and purification of protein A-Hia5-6XHis (pA-Hia5) for antibody directed DNA (adenine) methylation (as in DiMeLo-seq)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 222303 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepd861-SR
-
Backbone manufacturerATUM
- Backbone size w/o insert (bp) 2240
- Total vector size (bp) 3599
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepA-Hia5
-
Alt nameprotein A fusion to Hia5 DNA adenine methyltransferase
-
SpeciesHaemophilus influenzae
-
Insert Size (bp)1359
-
Mutationcodon optimized for bacterial expression
-
GenBank IDJF268249 AEV40923
- Promoter rhaBAD
-
Tags
/ Fusion Proteins
- protein A (N terminal on insert)
- 6His (C terminal on insert)
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer ATCTTTCCCTGGTTGCCAATGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThis plasmid was gene synthesized by ATUM.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
prhaBAD-pA-Hia5 was a gift from Aaron Straight (Addgene plasmid # 222303 ; http://n2t.net/addgene:222303 ; RRID:Addgene_222303) -
For your References section:
DiMeLo-seq: a long-read, single-molecule method for mapping protein-DNA interactions genome wide. Altemose N, Maslan A, Smith OK, Sundararajan K, Brown RR, Mishra R, Detweiler AM, Neff N, Miga KH, Straight AF, Streets A. Nat Methods. 2022 Jun;19(6):711-723. doi: 10.1038/s41592-022-01475-6. Epub 2022 Apr 8. 10.1038/s41592-022-01475-6 PubMed 35396487