-
PurposeExpress fussed dCas9-TurboID for proximity labeling
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 222599 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneLenti-dCas9-KRAB-blast
-
Modifications to backboneReplace KRAB with TurboID
-
Vector typeLentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedCas9-TurboID
-
Insert Size (bp)5175
- Promoter EF-1α
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gtcgtgacgtacggccaccatg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lenti-dCas9-TurboID-blast was a gift from Yarui Diao (Addgene plasmid # 222599 ; http://n2t.net/addgene:222599 ; RRID:Addgene_222599) -
For your References section:
Crosstalk between RNA m(6)A and DNA methylation regulates transposable element chromatin activation and cell fate in human pluripotent stem cells. Sun T, Xu Y, Xiang Y, Ou J, Soderblom EJ, Diao Y. Nat Genet. 2023 Aug;55(8):1324-1335. doi: 10.1038/s41588-023-01452-5. Epub 2023 Jul 20. 10.1038/s41588-023-01452-5 PubMed 37474847